chrom	pos	ref	alt	rsids	nearest_genes	pval	beta	sebeta	maf	ac	r2	peak	phenostring	phenocode
2	211540507	C	A	rs1047891	CPS1	1e-99	0.35	0.016	0.35	5704.0	0.053	True	Glycine (combined)	Gly_combined
11	61569830	C	T	rs174546	FADS1,FADS2	2e-85	-0.32	0.016	0.43	7444.7	0.043	True	Omega-3 fatty acids (combined)	FAw3_combined
16	57004889	G	A	rs7205804	CETP	3.5e-72	0.2	0.011	0.42	16080.7	0.017	True	HDL cholesterol (combined)	S_hdlc_combined
11	61570783	T	C	rs174547	FADS1,FADS2	1.9e-70	-0.29	0.016	0.42	7438.2	0.035	True	Docosahexaenoic acid (combined)	DHA_combined
19	45411941	T	C	rs429358	APOE	1.4e-65	-0.25	0.015	0.19	6765.4	0.016	True	C reactive protein (combined)	ln_P_CRP_combined
9	6533092	C	G	rs138640017	GLDC	9.1e-63	1.3	0.079	0.0097	160.0	0.034	True	Glycine (combined)	Gly_combined
1	55505647	G	T	rs11591147	PCSK9	3.1e-58	-0.43	0.026	0.041	1591.3	0.013	True	Total cholesterol (combined)	S_totalc_combined
1	55505647	G	T	rs11591147	PCSK9	7.3e-55	-0.5	0.032	0.042	1049.2	0.019	True	LDL cholesterol (combined)	S_ldlc_combined
3	186570746	T	G	rs17846866	ADIPOQ	5.4e-54	-0.33	0.021	0.088	2490.2	0.017	True	Adiponectin (combined)	ln_P_adipon_combined
12	56865338	A	G	rs2657879	GLS2,SPRYD4	5.8e-47	-0.29	0.02	0.19	3302.0	0.023	True	Glutamine (combined)	Gln_combined
1	55505647	G	T	rs11591147	PCSK9	8.8e-35	-0.42	0.034	0.042	929.2	0.014	True	Total cholesterol in IDL (combined)	IDL_C_combined
4	74853287	G	A	rs148885848	PPBP	2.6e-34	-0.61	0.05	0.019	412.0	0.014	True	Albumin (combined)	Alb_combined
11	116657561	C	T	rs3741298	ZPR1	4.6e-34	-0.2	0.016	0.23	19342.9	0.012	True	Triglycerides (combined)	ln_S_tottg_combined
19	45411941	T	C	rs429358	APOE	2.6e-31	0.17	0.014	0.19	7302.9	0.007	True	Total cholesterol (combined)	S_totalc_combined
1	55505647	G	T	rs11591147	PCSK9	3.2e-31	-0.4	0.034	0.042	929.2	0.012	True	Concentration of IDL particles (combined)	IDL_P_combined
12	121416622	C	G	rs1169289	HNF1A	4.2e-31	-0.14	0.012	0.49	18140.3	0.0075	True	C reactive protein (combined)	ln_P_CRP_combined
16	57004889	G	A	rs7205804	CETP	7.1e-31	0.16	0.014	0.41	9107.8	0.012	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
16	57004889	G	A	rs7205804	CETP	1.2e-30	0.14	0.012	0.42	12032.2	0.0091	True	ApoA1 (combined)	S_ApoA1_combined
19	11210912	C	T	rs2228671	LDLR	3.2e-30	-0.2	0.017	0.12	4588.3	0.0067	True	Total cholesterol (combined)	S_totalc_combined
19	45411941	T	C	rs429358	APOE	3.5e-29	0.18	0.016	0.19	5552.6	0.0087	True	ApoB (combined)	S_ApoB_combined
19	45397229	G	A	rs1160983	TOMM40	6.5e-29	-0.58	0.052	0.017	376.0	0.011	True	Total cholesterol in IDL (combined)	IDL_C_combined
19	45411941	T	C	rs429358	APOE	7.9e-29	0.19	0.017	0.19	4788.7	0.0099	True	LDL cholesterol (combined)	S_ldlc_combined
1	159684186	T	A	rs1417938	CRP	1.1e-28	0.13	0.011	0.35	12679.6	0.0069	True	C reactive protein (combined)	ln_P_CRP_combined
1	55505647	G	T	rs11591147	PCSK9	3.7e-28	-0.33	0.03	0.042	1207.2	0.0083	True	ApoB (combined)	S_ApoB_combined
19	45397229	G	A	rs1160983	TOMM40	2.6e-26	-0.55	0.052	0.017	376.0	0.01	True	Concentration of IDL particles (combined)	IDL_P_combined
4	74853287	G	A	rs148885848	PPBP	3.3e-26	0.4	0.038	0.019	743.0	0.0058	True	Total cholesterol (combined)	S_totalc_combined
19	11210912	C	T	rs2228671	LDLR	5.7e-26	-0.22	0.021	0.12	3105.3	0.0088	True	LDL cholesterol (combined)	S_ldlc_combined
2	27730940	T	C	rs1260326	GCKR	1.2e-25	-0.16	0.015	0.36	15997.1	0.0087	True	Triglycerides (combined)	ln_S_tottg_combined
11	116657561	C	T	rs3741298	ZPR1	1.8e-25	-0.18	0.017	0.23	16991.3	0.0099	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
1	66102257	G	A	rs1805096	LEPR	2e-23	-0.11	0.011	0.5	17947.1	0.0055	True	C reactive protein (combined)	ln_P_CRP_combined
2	21263900	G	A	rs1367117	APOB	1.4e-22	0.12	0.012	0.27	10508.0	0.0049	True	Total cholesterol (combined)	S_totalc_combined
2	169763148	T	C	rs560887	G6PC2,SPC25	5.6e-22	0.16	0.016	0.28	13936.0	0.0095	True	Glucose, fasting (combined)	glu_fast_combined
2	27730940	T	C	rs1260326	GCKR	4.2e-21	-0.16	0.017	0.37	11076.1	0.01	True	Alanine (combined)	Ala_combined
9	4697080	A	G	rs7025425	CDC37L1	2e-20	0.79	0.085	0.0086	141.1	0.01	True	Glycine (combined)	Gly_combined
1	55076137	CCACTCCACATTCAGACCGTCATCCCCAGG	C	rs373739034	ACOT11,FAM151A	1.4e-19	-0.16	0.018	0.099	3806.4	0.0042	True	Total cholesterol (combined)	S_totalc_combined
15	58855748	C	T	rs113298164	LIPC	1.9e-19	0.39	0.043	0.015	587.1	0.0042	True	HDL cholesterol (combined)	S_hdlc_combined
1	55505647	G	T	rs11591147	PCSK9	2.7e-19	-0.31	0.034	0.042	929.2	0.0073	True	Remnant cholesterol (combined)	Remnant_C_combined
15	58855748	C	T	rs113298164	LIPC	5.1e-19	0.45	0.05	0.015	422.1	0.0055	True	ApoA1 (combined)	S_ApoA1_combined
8	19816934	T	C	rs301	LPL	4.5e-18	0.11	0.013	0.22	8461.1	0.0039	True	HDL cholesterol (combined)	S_hdlc_combined
19	11210912	C	T	rs2228671	LDLR	5.9e-18	-0.17	0.02	0.12	3506.3	0.0051	True	ApoB (combined)	S_ApoB_combined
11	116657561	C	T	rs3741298	ZPR1	7.7e-18	-0.15	0.017	0.23	16996.3	0.0067	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
2	21263900	G	A	rs1367117	APOB	2.6e-17	0.12	0.014	0.27	7776.9	0.0049	True	ApoB (combined)	S_ApoB_combined
8	19816934	T	C	rs301	LPL	2.8e-17	-0.14	0.016	0.22	5483.9	0.0057	True	Triglycerides (combined)	ln_S_tottg_combined
19	11210912	C	T	rs2228671	LDLR	3.7e-17	-0.19	0.022	0.12	2621.5	0.0064	True	Total cholesterol in IDL (combined)	IDL_C_combined
11	116657561	C	T	rs3741298	ZPR1	4.8e-17	-0.13	0.015	0.23	22295.8	0.0049	True	ApoB (combined)	S_ApoB_combined
14	94844947	C	T	rs28929474	SERPINA1	5.1e-17	-0.41	0.049	0.02	433.0	0.0064	True	Glycoprotein acetyls (combined)	Gp_combined
19	11210912	C	T	rs2228671	LDLR	7.6e-17	-0.19	0.022	0.12	2621.5	0.0063	True	Concentration of IDL particles (combined)	IDL_P_combined
1	55224773	A	C	rs116816976	PARS2	8.7e-17	-0.19	0.023	0.089	2228.0	0.0055	True	LDL cholesterol (combined)	S_ldlc_combined
16	57005301	C	T	rs1532625	CETP	1e-16	-0.12	0.014	0.41	9112.1	0.0063	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
8	19816934	T	C	rs301	LPL	1.1e-16	0.14	0.017	0.22	4792.5	0.0062	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
2	27730940	T	C	rs1260326	GCKR	1.8e-16	-0.12	0.014	0.36	18459.1	0.0047	True	ApoB (combined)	S_ApoB_combined
1	55076137	CCACTCCACATTCAGACCGTCATCCCCAGG	C	rs373739034	ACOT11,FAM151A	5.4e-16	-0.19	0.023	0.1	2194.4	0.006	True	Total cholesterol in IDL (combined)	IDL_C_combined
19	19380513	A	G	rs187429064	TM6SF2	5.8e-16	-0.18	0.023	0.06	2298.0	0.0034	True	Total cholesterol (combined)	S_totalc_combined
4	74853287	G	A	rs148885848	PPBP	8.4e-16	0.38	0.047	0.018	462.0	0.0052	True	LDL cholesterol (combined)	S_ldlc_combined
1	109824250	G	A	rs35358959	PSRC1	2.3e-15	-0.16	0.021	0.13	3172.0	0.005	True	LDL cholesterol (combined)	S_ldlc_combined
15	58855748	C	T	rs113298164	LIPC	3.2e-15	0.46	0.058	0.014	301.1	0.0056	True	Phosphatidylcholine (combined)	PC_combined
2	27730940	T	C	rs1260326	GCKR	3.4e-15	-0.13	0.016	0.37	13940.1	0.0056	True	Glycoprotein acetyls (combined)	Gp_combined
2	21263900	G	A	rs1367117	APOB	5.2e-15	0.11	0.015	0.27	6726.9	0.0049	True	LDL cholesterol (combined)	S_ldlc_combined
16	71609856	C	T	rs78302875	TAT	9.1e-15	0.29	0.037	0.047	816.0	0.0068	True	Tyrosine (combined)	Tyr_combined
4	74853287	G	A	rs148885848	PPBP	1.4e-14	0.34	0.044	0.019	553.0	0.0041	True	ApoB (combined)	S_ApoB_combined
2	21263900	G	A	rs1367117	APOB	1.6e-14	0.12	0.016	0.27	5896.7	0.0054	True	Concentration of IDL particles (combined)	IDL_P_combined
2	27730940	T	C	rs1260326	GCKR	1.6e-14	-0.14	0.018	0.37	11065.1	0.0067	True	Monounsaturated fatty acids (combined)	MUFA_combined
1	109824250	G	A	rs35358959	PSRC1	2e-14	-0.15	0.019	0.13	3672.0	0.004	True	ApoB (combined)	S_ApoB_combined
11	116657561	C	T	rs3741298	ZPR1	2.1e-14	-0.13	0.017	0.23	16991.3	0.0053	True	Remnant cholesterol (combined)	Remnant_C_combined
4	74853287	G	A	rs148885848	PPBP	3.8e-14	0.38	0.05	0.019	411.0	0.0052	True	Glycoprotein acetyls (combined)	Gp_combined
18	47095862	C	T	rs201922257	LIPG	3.8e-14	0.77	0.1	0.0034	97.0	0.004	True	ApoA1 (combined)	S_ApoA1_combined
17	41926216	C	T	rs750623950	CD300LG	4.8e-14	2.1	0.27	0.00034	13.0	0.0029	True	HDL cholesterol (combined)	S_hdlc_combined
1	154426970	A	C	rs2228145	IL6R	4.8e-14	-0.098	0.013	0.28	10007.4	0.0032	True	C reactive protein (combined)	ln_P_CRP_combined
11	116657561	C	T	rs3741298	ZPR1	5.1e-14	-0.15	0.019	0.22	13581.0	0.0065	True	Monounsaturated fatty acids (combined)	MUFA_combined
12	96374381	C	A	rs141635447	HAL	5.5e-14	0.85	0.11	0.0046	80.0	0.0064	True	Histidine (combined)	His_combined
5	176836532	A	G	rs1801020	F12,GRK6	7.7e-14	0.13	0.018	0.26	12913.4	0.0064	True	Phenylalanine (combined)	Phe_combined
15	100692953	G	A	rs72755233	ADAMTS17	8.1e-14	-0.11	0.015	0.12	4797.5	0.0029	True	Height (combined)	height_combined
1	55076137	CCACTCCACATTCAGACCGTCATCCCCAGG	C	rs373739034	ACOT11,FAM151A	8.9e-14	-0.17	0.023	0.1	2193.4	0.005	True	Concentration of IDL particles (combined)	IDL_P_combined
15	58855748	C	T	rs113298164	LIPC	1.3e-13	0.43	0.058	0.014	301.1	0.005	True	Total phosphoglycerides (combined)	TotPG_combined
16	57005301	C	T	rs1532625	CETP	1.4e-13	-0.1	0.014	0.41	9112.1	0.005	True	Remnant cholesterol (combined)	Remnant_C_combined
19	19380513	A	G	rs187429064	TM6SF2	1.9e-13	-0.21	0.028	0.059	1478.0	0.0043	True	Triglycerides (combined)	ln_S_tottg_combined
11	116657561	C	T	rs3741298	ZPR1	2e-13	0.1	0.014	0.23	29559.1	0.0028	True	HDL cholesterol (combined)	S_hdlc_combined
1	109824250	G	A	rs35358959	PSRC1	2.8e-13	-0.13	0.018	0.12	4783.0	0.0028	True	Total cholesterol (combined)	S_totalc_combined
16	57007446	T	G	rs11076176	CETP	2.9e-13	-0.14	0.019	0.14	3161.6	0.0048	True	Total cholesterol in HDL3 (combined)	HDL3_C_combined
2	21263900	G	A	rs1367117	APOB	3.3e-13	0.11	0.016	0.27	5896.7	0.0048	True	Total cholesterol in IDL (combined)	IDL_C_combined
2	27730940	T	C	rs1260326	GCKR	4.4e-13	-0.11	0.015	0.37	13951.1	0.0048	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
1	63050598	T	G	rs3850634	DOCK7	7.3e-13	-0.094	0.013	0.25	9566.5	0.0027	True	Total cholesterol (combined)	S_totalc_combined
16	84075593	G	A	rs145119400	SLC38A8	8.9e-13	-0.34	0.047	0.019	527.2	0.0036	True	Adiponectin (combined)	ln_P_adipon_combined
11	116657561	C	T	rs3741298	ZPR1	9.1e-13	-0.14	0.019	0.22	13582.2	0.0058	True	Isoleucine (combined)	Ile_combined
15	59377940	C	T	rs181181625	RNF111	1e-12	0.35	0.05	0.012	461.0	0.0026	True	HDL cholesterol (combined)	S_hdlc_combined
15	59377940	C	T	rs181181625	RNF111	1.1e-12	0.41	0.057	0.011	331.0	0.0035	True	ApoA1 (combined)	S_ApoA1_combined
19	19388500	A	T	rs8107974	SUGP1	1.4e-12	-0.2	0.027	0.057	1640.9	0.0035	True	ApoB (combined)	S_ApoB_combined
16	67976823	C	T	rs199717050	LCAT	1.4e-12	-0.62	0.087	0.0035	136.2	0.0026	True	HDL cholesterol (combined)	S_hdlc_combined
18	47095862	C	T	rs201922257	LIPG	1.7e-12	0.67	0.095	0.0028	107.0	0.0026	True	HDL cholesterol (combined)	S_hdlc_combined
9	6012734	A	C	rs106033	RANBP6	2.8e-12	0.14	0.019	0.22	3552.6	0.0059	True	Glycine (combined)	Gly_combined
5	74651084	A	G	rs3846662	HMGCR	2.9e-12	0.077	0.011	0.47	18210.0	0.0025	True	Total cholesterol (combined)	S_totalc_combined
19	19675696	C	T	rs73004933	PBX4	3.9e-12	-0.17	0.024	0.058	2240.1	0.0025	True	Total cholesterol (combined)	S_totalc_combined
15	58855748	C	T	rs113298164	LIPC	4.1e-12	0.4	0.058	0.014	302.1	0.0044	True	Total cholesterol in HDL3 (combined)	HDL3_C_combined
7	73019975	A	G	rs61010704	MLXIPL	4.3e-12	-0.12	0.017	0.21	5183.4	0.0038	True	Triglycerides (combined)	ln_S_tottg_combined
11	116631707	T	C	rs3825041	BUD13	4.8e-12	-0.18	0.026	0.082	20156.0	0.0043	True	Glycoprotein acetyls (combined)	Gp_combined
19	45397229	G	A	rs1160983	TOMM40	7.3e-12	-0.36	0.052	0.017	376.0	0.0043	True	Sphingomyelins (combined)	SM_combined
19	19380513	A	G	rs187429064	TM6SF2	8.8e-12	-0.23	0.034	0.055	971.0	0.0053	True	Omega-3 fatty acids (combined)	FAw3_combined
2	44066247	G	C	rs11887534	ABCG8	8.8e-12	-0.13	0.019	0.094	3638.8	0.0024	True	Total cholesterol (combined)	S_totalc_combined
11	116657561	C	T	rs3741298	ZPR1	9.7e-12	0.12	0.017	0.23	16991.3	0.0042	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
16	69458488	C	G		CYB5B	1.2e-11	0.7	0.1	0.0044	96.1	0.0042	True	Pyruvate (combined)	Pyr_combined
16	83813806	A	T	rs186440718	CDH13	1.7e-11	-0.36	0.053	0.013	369.2	0.0032	True	Adiponectin (combined)	ln_P_adipon_combined
19	45410002	G	A	rs769449	APOE	2.1e-11	-0.1	0.015	0.17	6615.4	0.0023	True	HDL cholesterol (combined)	S_hdlc_combined
12	56865338	A	G	rs2657879	GLS2,SPRYD4	2.2e-11	0.14	0.02	0.19	3305.0	0.0051	True	Tyrosine (combined)	Tyr_combined
6	111528041	T	C	rs12191266	SLC16A10	2.8e-11	0.17	0.026	0.1	1827.2	0.005	True	Tyrosine (combined)	Tyr_combined
11	116657561	C	T	rs3741298	ZPR1	4.1e-11	-0.13	0.019	0.22	13581.0	0.005	True	Linoleic acid (combined)	LA_combined
19	11210912	C	T	rs2228671	LDLR	4.2e-11	-0.15	0.023	0.12	2621.5	0.004	True	Remnant cholesterol (combined)	Remnant_C_combined
19	19675696	C	T	rs73004933	PBX4	4.2e-11	-0.18	0.027	0.058	1683.9	0.003	True	ApoB (combined)	S_ApoB_combined
8	19816934	T	C	rs301	LPL	4.2e-11	-0.11	0.017	0.22	4792.5	0.004	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
19	11210912	C	T	rs2228671	LDLR	4.3e-11	-0.16	0.024	0.12	2157.4	0.005	True	Linoleic acid (combined)	LA_combined
16	81095363	C	T	rs804885	AC092718.3,AC092718.8,C16orf46	4.7e-11	0.15	0.022	0.17	13555.5	0.0053	True	Glycine (combined)	Gly_combined
1	63113511	C	A	rs746735	DOCK7	4.7e-11	0.11	0.017	0.25	16584.1	0.0039	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
19	19675696	C	T	rs73004933	PBX4	5.4e-11	-0.22	0.034	0.059	1028.4	0.0049	True	Omega-3 fatty acids (combined)	FAw3_combined
1	54723658	T	C	rs72664201	SSBP3	5.8e-11	-0.2	0.03	0.049	1238.0	0.0034	True	LDL cholesterol (combined)	S_ldlc_combined
12	103248924	C	T	rs1126758	PAH	6.2e-11	-0.1	0.016	0.39	10675.0	0.0049	True	Phenylalanine (combined)	Phe_combined
2	27730940	T	C	rs1260326	GCKR	6.4e-11	-0.12	0.018	0.37	11063.1	0.0049	True	Isoleucine (combined)	Ile_combined
16	72055088	G	A	rs201970636	DHODH	6.8e-11	0.65	0.099	0.0049	106.1	0.0039	True	Pyruvate (combined)	Pyr_combined
4	72618323	G	T	rs4588	GC	7.1e-11	-0.2	0.03	0.2	1399.2	0.012	True	Vitamin D (combined)	ln_Vitamin_D_combined
1	54649648	C	CTAAA	rs369421518,rs781325854	AL357673.1,CYB5RL	8e-11	-0.12	0.018	0.12	4698.7	0.0022	True	Total cholesterol (combined)	S_totalc_combined
4	74853287	G	A	rs148885848	PPBP	8.3e-11	0.33	0.05	0.019	410.0	0.0038	True	Sphingomyelins (combined)	SM_combined
19	19329924	C	T	rs2228603	NCAN	9e-11	-0.21	0.033	0.062	1089.4	0.0048	True	Docosahexaenoic acid (combined)	DHA_combined
9	107665739	G	A	rs2575876	ABCA1	9.6e-11	-0.093	0.014	0.18	6757.1	0.0022	True	HDL cholesterol (combined)	S_hdlc_combined
2	21237544	G	A	rs673548	APOB	9.9e-11	-0.097	0.015	0.26	6565.0	0.0033	True	Triglycerides (combined)	ln_S_tottg_combined
19	45411941	T	C	rs429358	APOE	1.1e-10	0.12	0.018	0.19	4178.1	0.0038	True	Remnant cholesterol (combined)	Remnant_C_combined
16	55862682	G	A	rs144498758	CES1	1.1e-10	0.77	0.12	0.0018	68.0	0.0022	True	HDL cholesterol (combined)	S_hdlc_combined
16	67981640	G	A		SLC12A4	1.4e-10	0.66	0.1	0.0045	98.0	0.0038	True	Pyruvate (combined)	Pyr_combined
1	63001120	A	C	rs1168018	DOCK7	1.6e-10	0.1	0.016	0.25	16559.8	0.0037	True	Total phosphoglycerides (combined)	TotPG_combined
11	68562328	C	T	rs2229738	CPT1A	1.8e-10	-0.14	0.021	0.16	2865.1	0.0046	True	Docosahexaenoic acid (combined)	DHA_combined
15	58855748	C	T	rs113298164	LIPC	1.9e-10	0.37	0.059	0.014	301.1	0.0037	True	Total cholines (combined)	TotCho_combined
19	11210912	C	T	rs2228671	LDLR	2.1e-10	-0.14	0.022	0.12	2616.5	0.0037	True	Sphingomyelins (combined)	SM_combined
19	8429323	G	A	rs116843064	ANGPTL4	2.4e-10	0.29	0.045	0.024	520.1	0.0036	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
11	61564299	G	T	rs4246215	FADS2,FEN1	2.6e-10	-0.096	0.015	0.45	9919.0	0.0036	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
5	74639544	CTTGTA	C	rs3064191,rs10590407	HMGCR	2.6e-10	0.085	0.013	0.45	11264.0	0.0032	True	LDL cholesterol (combined)	S_ldlc_combined
15	59377940	C	T	rs181181625	RNF111	2.7e-10	0.42	0.066	0.011	237.0	0.0036	True	Phosphatidylcholine (combined)	PC_combined
19	19380513	A	G	rs187429064	TM6SF2	2.9e-10	-0.19	0.03	0.057	1260.0	0.0036	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
19	54823533	T	C	rs1761463	LILRA5	3.1e-10	0.071	0.011	0.38	14812.1	0.0021	True	HDL cholesterol (combined)	S_hdlc_combined
13	96086089	T	A	rs780076642	CLDN10	3.1e-10	0.8	0.13	0.0018	62.0	0.0022	True	Creatinine (combined)	S_krea_combined
2	21237544	G	A	rs673548	APOB	3.4e-10	0.079	0.013	0.26	10137.1	0.002	True	HDL cholesterol (combined)	S_hdlc_combined
2	27730940	T	C	rs1260326	GCKR	3.5e-10	-0.094	0.015	0.37	13825.1	0.0036	True	Pyruvate (combined)	Pyr_combined
2	44066247	G	C	rs11887534	ABCG8	3.6e-10	-0.14	0.022	0.095	2388.0	0.0031	True	LDL cholesterol (combined)	S_ldlc_combined
13	96086089	T	A	rs780076642	CLDN10	4.2e-10	-0.79	0.13	0.0018	62.0	0.0022	True	Glomerular filtration rate (combined)	eGFR_MDRD_combined
17	6942030	T	C	rs144261582	SLC16A13	4.5e-10	0.5	0.081	0.004	153.0	0.002	True	Height (combined)	height_combined
19	11210912	C	T	rs2228671	LDLR	4.7e-10	-0.15	0.025	0.12	2157.4	0.0044	True	Omega-6 fatty acids (combined)	FAw6_combined
11	116657561	C	T	rs3741298	ZPR1	4.9e-10	-0.083	0.013	0.23	29561.1	0.002	True	Total cholesterol (combined)	S_totalc_combined
20	43042364	C	T	rs1800961	HNF4A	5.4e-10	-0.17	0.027	0.037	1442.8	0.002	True	HDL cholesterol (combined)	S_hdlc_combined
9	5763873	C	A	rs117881871	RIC1	5.9e-10	0.19	0.031	0.07	1153.0	0.0047	True	Glycine (combined)	Gly_combined
16	72108093	G	A	rs2000999	HPR,TXNL4B	5.9e-10	-0.12	0.019	0.2	4337.0	0.0035	True	Glycoprotein acetyls (combined)	Gp_combined
2	27730940	T	C	rs1260326	GCKR	6.5e-10	-0.11	0.017	0.37	11071.1	0.0044	True	Leucine (combined)	Leu_combined
8	19816934	T	C	rs301	LPL	6.6e-10	-0.091	0.015	0.22	6310.0	0.0026	True	ApoB (combined)	S_ApoB_combined
17	6591098	A	T	rs218692	C17orf100,SLC13A5	6.7e-10	0.086	0.014	0.45	9972.6	0.0035	True	Citrate (combined)	Cit_combined
1	55505647	G	T	rs11591147	PCSK9	7.5e-10	-0.21	0.034	0.042	927.2	0.0034	True	Sphingomyelins (combined)	SM_combined
19	19675696	C	T	rs73004933	PBX4	7.6e-10	-0.21	0.034	0.059	1028.4	0.0043	True	Docosahexaenoic acid (combined)	DHA_combined
1	63001120	A	C	rs1168018	DOCK7	8.2e-10	0.1	0.016	0.25	16559.8	0.0034	True	Phosphatidylcholine (combined)	PC_combined
15	100692953	G	A	rs72755233	ADAMTS17	8.8e-10	-0.096	0.016	0.12	4796.5	0.002	True	Waist (combined)	waist_combined
7	73013901	C	T	rs13235543	MLXIPL	9.2e-10	-0.14	0.022	0.12	2578.7	0.0034	True	Glycoprotein acetyls (combined)	Gp_combined
15	59500346	C	T	rs76501863	LDHAL6B,MYO1E	1e-09	0.16	0.027	0.077	1686.7	0.0034	True	Total phosphoglycerides (combined)	TotPG_combined
10	99359739	T	C	rs2297644	AL355315.1,HOGA1	1.1e-09	0.12	0.02	0.19	3234.4	0.0043	True	Glutamine (combined)	Gln_combined
2	21263900	G	A	rs1367117	APOB	1.1e-09	0.096	0.016	0.27	5896.7	0.0034	True	Remnant cholesterol (combined)	Remnant_C_combined
19	19388500	A	T	rs8107974	SUGP1	1.2e-09	-0.18	0.029	0.057	1430.6	0.003	True	LDL cholesterol (combined)	S_ldlc_combined
19	17777288	G	A	rs530358006	UNC13A	1.2e-09	1.8	0.3	0.00031	11.8	0.0019	True	Total cholesterol (combined)	S_totalc_combined
1	63090858	C	T	rs6587980	DOCK7	1.2e-09	-0.097	0.016	0.24	6156.9	0.0029	True	Triglycerides (combined)	ln_S_tottg_combined
4	74853287	G	A	rs148885848	PPBP	1.5e-09	0.3	0.05	0.019	412.0	0.0033	True	Concentration of IDL particles (combined)	IDL_P_combined
11	116657561	C	T	rs3741298	ZPR1	1.6e-09	-0.12	0.019	0.22	13581.0	0.0041	True	Polyunsaturated fatty acids (combined)	PUFA_combined
19	19380513	A	G	rs187429064	TM6SF2	1.6e-09	-0.18	0.03	0.057	1260.0	0.0033	True	Remnant cholesterol (combined)	Remnant_C_combined
19	10916684	C	T	rs2287029	DNM2	1.7e-09	-0.12	0.02	0.16	3432.1	0.0033	True	Concentration of IDL particles (combined)	IDL_P_combined
11	116728630	G	C	rs12225230	SIK3	1.7e-09	0.098	0.016	0.2	5665.9	0.0025	True	ApoA1 (combined)	S_ApoA1_combined
2	27730940	T	C	rs1260326	GCKR	1.9e-09	-0.095	0.016	0.37	13946.1	0.0033	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
5	14711275	T	C	rs3045	ANKH	2e-09	0.15	0.025	0.08	1761.8	0.0033	True	Citrate (combined)	Cit_combined
11	68562328	C	T	rs2229738	CPT1A	2e-09	-0.13	0.021	0.16	2865.1	0.0041	True	Omega-3 fatty acids (combined)	FAw3_combined
12	56865338	A	G	rs2657879	GLS2,SPRYD4	2.2e-09	0.12	0.02	0.19	3307.0	0.0041	True	Alanine (combined)	Ala_combined
11	116657561	C	T	rs3741298	ZPR1	2.2e-09	-0.11	0.019	0.22	13579.0	0.0041	True	Saturated fatty acids (combined)	SFA_combined
19	8429323	G	A	rs116843064	ANGPTL4	2.2e-09	-0.26	0.043	0.023	586.1	0.0028	True	Triglycerides (combined)	ln_S_tottg_combined
1	63070537	AGTTAATGTG	A	rs67461605,rs34483103	ANGPTL3,DOCK7	2.5e-09	-0.1	0.017	0.25	5383.9	0.0032	True	Remnant cholesterol (combined)	Remnant_C_combined
3	171969077	C	G	rs7652177	FNDC3B	2.5e-09	0.06	0.01	0.47	20505.2	0.0018	True	Height (combined)	height_combined
11	116657561	C	T	rs3741298	ZPR1	2.6e-09	-0.11	0.019	0.22	13581.0	0.004	True	Omega-6 fatty acids (combined)	FAw6_combined
1	63050598	T	G	rs3850634	DOCK7	2.7e-09	-0.087	0.015	0.25	7097.8	0.0024	True	ApoB (combined)	S_ApoB_combined
19	19789528	A	G	rs2304130	ZNF101	2.7e-09	-0.19	0.031	0.051	1127.0	0.0032	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
22	19197896	T	C	rs698423	CLTCL1	2.8e-09	-0.087	0.015	0.33	14685.5	0.0032	True	Citrate (combined)	Cit_combined
19	11210912	C	T	rs2228671	LDLR	2.9e-09	-0.15	0.025	0.12	2157.4	0.004	True	Polyunsaturated fatty acids (combined)	PUFA_combined
7	2802522	T	C	rs798488	AMZ1,GNA12	3.7e-09	-0.067	0.011	0.38	14557.7	0.0018	True	Height (combined)	height_combined
2	27730940	T	C	rs1260326	GCKR	3.8e-09	-0.075	0.013	0.36	24673.1	0.0018	True	Total cholesterol (combined)	S_totalc_combined
6	126669479	C	A	rs9401876	CENPW	3.8e-09	0.061	0.01	0.44	16852.8	0.0018	True	Height (combined)	height_combined
1	63096781	C	G	rs12025800	DOCK7	3.9e-09	-0.11	0.019	0.24	4264.2	0.004	True	Polyunsaturated fatty acids (combined)	PUFA_combined
1	149906413	T	C	rs11205303	MTMR11	3.9e-09	0.072	0.012	0.3	11646.1	0.0018	True	Height (combined)	height_combined
19	10916684	C	T	rs2287029	DNM2	4.6e-09	-0.12	0.02	0.16	3432.1	0.0031	True	Total cholesterol in IDL (combined)	IDL_C_combined
15	59377940	C	T	rs181181625	RNF111	4.9e-09	0.38	0.065	0.011	238.0	0.0031	True	Total cholesterol in HDL3 (combined)	HDL3_C_combined
19	45410002	G	A	rs769449	APOE	4.9e-09	-0.1	0.017	0.17	5035.0	0.0024	True	ApoA1 (combined)	S_ApoA1_combined
16	67981640	G	A		SLC12A4	5e-09	0.73	0.12	0.0039	68.0	0.0039	True	Alanine (combined)	Ala_combined
3	48229366	C	A	rs146179438	CDC25A	5.1e-09	-0.13	0.022	0.11	4139.9	0.0018	True	HDL cholesterol (combined)	S_hdlc_combined
3	186793242	G	A	rs2239612	ST6GAL1	5.1e-09	-0.1	0.018	0.14	3865.6	0.0024	True	Adiponectin (combined)	ln_P_adipon_combined
19	8429323	G	A	rs116843064	ANGPTL4	5.4e-09	0.2	0.035	0.024	920.8	0.0018	True	HDL cholesterol (combined)	S_hdlc_combined
11	117095283	C	T	rs59781045	PCSK7	5.5e-09	0.15	0.025	0.091	2000.0	0.0031	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
19	11210912	C	T	rs2228671	LDLR	5.8e-09	-0.13	0.022	0.12	2616.5	0.0031	True	Total cholines (combined)	TotCho_combined
19	45397229	G	A	rs1160983	TOMM40	6e-09	-0.3	0.052	0.017	376.0	0.0031	True	Total cholines (combined)	TotCho_combined
12	102591269	G	T	rs200627654	PARPBP,PMCH	6e-09	-1.9	0.33	0.00043	9.5	0.0031	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
19	19380513	A	G	rs187429064	TM6SF2	6.4e-09	-0.2	0.034	0.055	971.0	0.0038	True	Polyunsaturated fatty acids (combined)	PUFA_combined
5	176516631	G	A	rs1966265	FGFR4	6.4e-09	0.072	0.012	0.25	9453.3	0.0018	True	Waist (combined)	waist_combined
2	27730940	T	C	rs1260326	GCKR	6.6e-09	-0.098	0.017	0.37	11063.1	0.0038	True	Saturated fatty acids (combined)	SFA_combined
4	74853287	G	A	rs148885848	PPBP	6.8e-09	0.29	0.05	0.019	412.0	0.0031	True	Remnant cholesterol (combined)	Remnant_C_combined
11	117095283	C	T	rs59781045	PCSK7	7e-09	0.12	0.02	0.09	3471.2	0.0017	True	HDL cholesterol (combined)	S_hdlc_combined
2	21237544	G	A	rs673548	APOB	7.1e-09	-0.092	0.016	0.26	5755.6	0.003	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
8	19816934	T	C	rs301	LPL	7.2e-09	0.087	0.015	0.22	6310.0	0.0023	True	ApoA1 (combined)	S_ApoA1_combined
15	58855748	C	T	rs113298164	LIPC	7.4e-09	0.34	0.059	0.014	302.1	0.003	True	Concentration of IDL particles (combined)	IDL_P_combined
19	19789528	A	G	rs2304130	ZNF101	8.3e-09	-0.17	0.029	0.053	1317.0	0.0026	True	LDL cholesterol (combined)	S_ldlc_combined
7	92244422	C	T	rs42039	CDK6	8.5e-09	0.08	0.014	0.23	8869.8	0.0017	True	Height (combined)	height_combined
5	176516631	G	A	rs1966265	FGFR4	9.7e-09	0.074	0.013	0.25	9462.8	0.0017	True	Height (combined)	height_combined
1	63096781	C	G	rs12025800	DOCK7	9.9e-09	-0.11	0.019	0.24	4264.2	0.0037	True	Omega-6 fatty acids (combined)	FAw6_combined
3	48601774	A	G	rs74780677	COL7A1	1e-08	-0.14	0.025	0.081	3109.6	0.0017	True	HDL cholesterol (combined)	S_hdlc_combined
19	19379549	C	T	rs58542926	TM6SF2	1e-08	-0.17	0.03	0.057	1258.8	0.003	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
1	63096781	C	G	rs12025800	DOCK7	1.1e-08	-0.11	0.018	0.24	4264.2	0.0037	True	Linoleic acid (combined)	LA_combined
9	107651526	A	G	rs2275545	ABCA1	1.2e-08	-0.11	0.019	0.12	3329.3	0.0022	True	ApoA1 (combined)	S_ApoA1_combined
16	56691920	C	T	rs375184697	MT1F	1.3e-08	-0.26	0.045	0.014	531.2	0.0017	True	HDL cholesterol (combined)	S_hdlc_combined
12	94613764	AT	A	rs3833789,rs796380143	PLXNC1	1.4e-08	-0.075	0.013	0.19	7382.7	0.0017	True	Height (combined)	height_combined
7	73013901	C	T	rs13235543	MLXIPL	1.6e-08	-0.12	0.022	0.12	2578.7	0.0029	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
4	77274242	T	C	rs12504985	CCDC158	1.6e-08	-0.064	0.011	0.4	21314.0	0.0018	True	Glomerular filtration rate (combined)	eGFR_MDRD_combined
19	20150175	G	C	rs2286922	ZNF682	1.7e-08	0.1	0.018	0.2	17673.9	0.0029	True	Remnant cholesterol (combined)	Remnant_C_combined
3	125831672	G	A	rs780671030	ALDH1L1	1.8e-08	-0.87	0.15	0.0026	42.3	0.0039	True	Glycine (combined)	Gly_combined
8	19816934	T	C	rs301	LPL	1.9e-08	-0.095	0.017	0.22	4788.5	0.0029	True	Glycoprotein acetyls (combined)	Gp_combined
18	47095862	C	T	rs201922257	LIPG	2.3e-08	0.61	0.11	0.0038	84.0	0.0028	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
4	74853287	G	A	rs148885848	PPBP	2.3e-08	0.28	0.05	0.019	412.0	0.0028	True	Total cholesterol in IDL (combined)	IDL_C_combined
19	51324910	C	T	rs779946534	KLK1	2.3e-08	3.2	0.57	0.00017	3.0	0.0036	True	Phenylalanine (combined)	Phe_combined
19	8429323	G	A	rs116843064	ANGPTL4	2.4e-08	-0.25	0.045	0.024	520.1	0.0028	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
1	55505647	G	T	rs11591147	PCSK9	2.5e-08	-0.21	0.038	0.042	737.2	0.0035	True	Linoleic acid (combined)	LA_combined
19	20150175	G	C	rs2286922	ZNF682	2.5e-08	0.1	0.018	0.2	17673.9	0.0028	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
19	42584958	C	T	rs201596848	ZNF574	2.6e-08	-0.33	0.059	0.011	314.0	0.0021	True	ApoB (combined)	S_ApoB_combined
19	42584958	C	T	rs201596848	ZNF574	2.7e-08	-0.37	0.066	0.0096	241.0	0.0025	True	LDL cholesterol (combined)	S_ldlc_combined
7	103251161	G	C	rs362691	RELN	2.7e-08	-0.23	0.04	0.093	660.5	0.0087	True	Vitamin D (combined)	ln_Vitamin_D_combined
16	81914620	G	C		PLCG2	3e-08	-0.35	0.064	0.0088	248.6	0.0022	True	Adiponectin (combined)	ln_P_adipon_combined
17	39616634	T	G		KRT32	3.2e-08	2.4	0.44	0.00013	5.2	0.0016	True	HDL cholesterol (combined)	S_hdlc_combined
17	39135270	A	G		KRT40	3.2e-08	2.4	0.44	0.00013	5.0	0.0016	True	HDL cholesterol (combined)	S_hdlc_combined
16	72055088	G	A	rs201970636	DHODH	3.4e-08	0.62	0.11	0.0047	82.0	0.0035	True	Alanine (combined)	Ala_combined
4	77274242	T	C	rs12504985	CCDC158	3.5e-08	0.063	0.011	0.4	21314.0	0.0017	True	Creatinine (combined)	S_krea_combined
19	11210912	C	T	rs2228671	LDLR	3.9e-08	-0.12	0.022	0.12	2616.5	0.0027	True	Total phosphoglycerides (combined)	TotPG_combined
11	117352857	G	A	rs147554220	DSCAML1	4e-08	0.3	0.054	0.016	350.1	0.0027	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
16	57279408	G	GGGGCC	rs536362342	ARL2BP	4.5e-08	-0.18	0.034	0.029	1128.6	0.0015	True	HDL cholesterol (combined)	S_hdlc_combined
2	28268467	C	T	rs6738887	BABAM2	4.5e-08	0.08	0.015	0.32	16985.4	0.0024	True	Triglycerides (combined)	ln_S_tottg_combined
14	21486590	C	T	rs74036552	NDRG2	4.7e-08	0.15	0.027	0.086	1510.1	0.0034	True	Histidine (combined)	His_combined
16	69729029	G	A	rs200584511	NFAT5	4.9e-08	0.63	0.12	0.0034	75.0	0.0027	True	Pyruvate (combined)	Pyr_combined
15	58855748	C	T	rs113298164	LIPC	5.4e-08	0.36	0.067	0.013	232.0	0.0034	True	Monounsaturated fatty acids (combined)	MUFA_combined
19	19379549	C	T	rs58542926	TM6SF2	5.5e-08	-0.19	0.035	0.057	1003.5	0.0034	True	Monounsaturated fatty acids (combined)	MUFA_combined
19	10683762	A	T	rs369295276	AP1M2	5.7e-08	-0.28	0.052	0.016	451.2	0.002	True	ApoB (combined)	S_ApoB_combined
18	29769910	G	A	rs144242131	GAREM1,MEP1B	6e-08	-0.25	0.046	0.015	560.2	0.0015	True	HDL cholesterol (combined)	S_hdlc_combined
1	55505647	G	T	rs11591147	PCSK9	6.4e-08	-0.18	0.034	0.042	929.2	0.0027	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
4	8608634	C	T	rs2302580	CPZ,GPR78	6.4e-08	-0.06	0.011	0.41	15595.8	0.0015	True	Waist (combined)	waist_combined
2	210846867	A	G	rs2723222	UNC80	6.6e-08	-0.087	0.016	0.46	7573.7	0.0036	True	Glycine (combined)	Gly_combined
5	176836532	A	G	rs1801020	F12,GRK6	6.6e-08	0.095	0.017	0.26	12905.4	0.0033	True	Histidine (combined)	His_combined
15	59377940	C	T	rs181181625	RNF111	6.6e-08	0.36	0.067	0.011	238.0	0.0027	True	Concentration of IDL particles (combined)	IDL_P_combined
15	59500346	C	T	rs76501863	LDHAL6B,MYO1E	6.8e-08	0.15	0.027	0.077	1686.7	0.0027	True	Total cholines (combined)	TotCho_combined
5	41927423	A	G	rs277414	FBXO4	7e-08	-0.082	0.015	0.28	6220.3	0.0026	True	Acetoacetate (combined)	ln_AcAce_combined
16	69458488	C	G		CYB5B	7.3e-08	0.67	0.12	0.0039	68.1	0.0033	True	Alanine (combined)	Ala_combined
19	11210912	C	T	rs2228671	LDLR	7.5e-08	-0.12	0.022	0.12	2616.5	0.0026	True	Phosphatidylcholine (combined)	PC_combined
19	45396219	C	T	rs157582	TOMM40	7.6e-08	0.089	0.017	0.22	5550.5	0.0023	True	Triglycerides (combined)	ln_S_tottg_combined
5	55809465	A	G	rs173964	C5orf67	7.6e-08	-0.061	0.011	0.33	25903.6	0.0015	True	WHR (combined)	whr_combined
1	52956522	G	A	rs138786668	ZCCHC11	7.7e-08	-0.21	0.039	0.03	750.3	0.0023	True	LDL cholesterol (combined)	S_ldlc_combined
17	41926216	C	T	rs750623950	CD300LG	8.1e-08	1.7	0.32	0.00035	10.0	0.002	True	ApoA1 (combined)	S_ApoA1_combined
20	34025756	A	G	rs143384	GDF5	8.2e-08	0.071	0.013	0.44	17003.9	0.0015	True	Height (combined)	height_combined
15	58855748	C	T	rs113298164	LIPC	9.2e-08	0.35	0.066	0.013	232.0	0.0033	True	Saturated fatty acids (combined)	SFA_combined
19	19789528	A	G	rs2304130	ZNF101	9.6e-08	-0.19	0.036	0.051	891.0	0.0032	True	Polyunsaturated fatty acids (combined)	PUFA_combined
19	45397229	G	A	rs1160983	TOMM40	9.8e-08	-0.31	0.059	0.017	302.0	0.0032	True	Linoleic acid (combined)	LA_combined
4	74853287	G	A	rs148885848	PPBP	1e-07	0.27	0.05	0.019	410.0	0.0026	True	Total cholines (combined)	TotCho_combined
6	127637099	T	C	rs78728476	ECHDC1	1e-07	0.3	0.056	0.033	326.0	0.0057	True	WHR (females)	whr_females
1	110029023	C	T	rs77956617	ATXN7L2	1.1e-07	-0.26	0.049	0.016	466.1	0.0019	True	ApoB (combined)	S_ApoB_combined
12	56865338	A	G	rs2657879	GLS2,SPRYD4	1.2e-07	0.11	0.02	0.19	3304.0	0.0032	True	Histidine (combined)	His_combined
2	21263900	G	A	rs1367117	APOB	1.2e-07	0.082	0.015	0.27	5890.7	0.0026	True	Sphingomyelins (combined)	SM_combined
17	59485555	C	T	rs1057987	TBX2	1.2e-07	0.064	0.012	0.28	25384.8	0.0016	True	Glomerular filtration rate (combined)	eGFR_MDRD_combined
17	41926216	C	T	rs750623950	CD300LG	1.3e-07	2.2	0.41	0.00027	6.0	0.0025	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
1	54649648	C	CTAAA	rs369421518,rs781325854	AL357673.1,CYB5RL	1.3e-07	-0.12	0.023	0.12	2691.5	0.0025	True	Total cholesterol in IDL (combined)	IDL_C_combined
1	63001120	A	C	rs1168018	DOCK7	1.3e-07	0.099	0.019	0.24	13268.7	0.0032	True	Monounsaturated fatty acids (combined)	MUFA_combined
1	177225022	C	G	rs74706687	BRINP2	1.3e-07	1.2	0.23	0.00066	19.0	0.0019	True	ApoA1 (combined)	S_ApoA1_combined
17	59485555	C	T	rs1057987	TBX2	1.3e-07	-0.064	0.012	0.28	25384.8	0.0016	True	Creatinine (combined)	S_krea_combined
19	10463579	C	G	rs12720360	TYK2	1.4e-07	-0.29	0.054	0.015	435.5	0.0019	True	ApoB (combined)	S_ApoB_combined
11	47282929	A	G	rs199947343	NR1H3	1.4e-07	0.42	0.081	0.0042	162.0	0.0014	True	HDL cholesterol (combined)	S_hdlc_combined
1	63096781	C	G	rs12025800	DOCK7	1.4e-07	-0.088	0.017	0.25	5419.8	0.0025	True	Total cholines (combined)	TotCho_combined
15	74336633	T	C	rs5742915	PML	1.4e-07	0.06	0.011	0.4	15501.5	0.0014	True	Height (combined)	height_combined
4	122254262	A	C	rs76291924	QRFPR	1.4e-07	-0.95	0.18	0.00073	28.1	0.0014	True	Systolic BP (combined)	systbp_combined
1	109824250	G	A	rs35358959	PSRC1	1.5e-07	-0.12	0.022	0.13	2782.0	0.0025	True	Concentration of IDL particles (combined)	IDL_P_combined
11	61551356	T	C	rs174535	MYRF,TMEM258	1.5e-07	0.077	0.015	0.43	10703.4	0.0022	True	Triglycerides (combined)	ln_S_tottg_combined
8	124250258	T	G	rs746450801	C8orf76,ZHX1-C8orf76	1.5e-07	-0.5	0.095	0.003	115.2	0.0014	True	Weight (combined)	weight_combined
4	74853287	G	A	rs148885848	PPBP	1.6e-07	0.31	0.058	0.017	305.0	0.0031	True	Polyunsaturated fatty acids (combined)	PUFA_combined
19	20150175	G	C	rs2286922	ZNF682	1.6e-07	0.083	0.016	0.2	23192.9	0.0019	True	ApoB (combined)	S_ApoB_combined
7	72877166	T	C	rs2074755	BAZ1B	1.7e-07	-0.13	0.025	0.11	1995.9	0.0031	True	Monounsaturated fatty acids (combined)	MUFA_combined
19	10916684	C	T	rs2287029	DNM2	1.7e-07	-0.094	0.018	0.16	4495.2	0.0019	True	ApoB (combined)	S_ApoB_combined
3	158178856	G	A	rs73172119	RSRC1	1.7e-07	0.1	0.02	0.17	3301.0	0.0029	True	Insulin, 2 hour (combined)	ln_P_ins120_combined
15	58855748	C	T	rs113298164	LIPC	1.8e-07	0.35	0.066	0.013	232.0	0.0031	True	Docosahexaenoic acid (combined)	DHA_combined
1	55181650	C	T	rs144220243	MROH7-TTC4,TTC4	1.8e-07	-2.9	0.55	8e-05	3.0	0.0014	True	Height (combined)	height_combined
11	61543961	T	C	rs174529	MYRF,TMEM258	2.1e-07	0.085	0.016	0.43	7500.7	0.0031	True	Linoleic acid (combined)	LA_combined
15	40907456	C	T		KNL1	2.2e-07	-2.1	0.41	0.00013	5.0	0.0014	True	Height (combined)	height_combined
15	58855748	C	T	rs113298164	LIPC	2.3e-07	0.3	0.059	0.014	302.1	0.0024	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
19	42584958	C	T	rs201596848	ZNF574	2.3e-07	-0.35	0.068	0.01	230.0	0.0024	True	Total cholesterol in IDL (combined)	IDL_C_combined
1	223940744	C	A		CAPN2	2.3e-07	-2.8	0.53	8e-05	3.0	0.0014	True	Height (combined)	height_combined
16	83065664	G	A	rs6565105	CDH13	2.3e-07	-0.065	0.012	0.37	17845.2	0.0019	True	Adiponectin (combined)	ln_P_adipon_combined
14	106311900	C	T	rs767216019	IGHD	2.3e-07	1.2	0.24	0.00087	17.0	0.0027	True	Insulin, fasting (combined)	ln_ins_fast_combined
7	100200925	A	G	rs538523505	PCOLCE	2.4e-07	-0.48	0.093	0.0065	113.8	0.0031	True	Glutamine (combined)	Gln_combined
4	187172353	C	CT	rs561791802,rs4253300	KLKB1	2.4e-07	0.081	0.016	0.45	7876.8	0.003	True	Histidine (combined)	His_combined
2	27730940	T	C	rs1260326	GCKR	2.5e-07	0.089	0.017	0.37	11048.1	0.003	True	Glutamine (combined)	Gln_combined
8	23198770	A	G		LOXL2	2.5e-07	-1.3	0.25	0.00039	15.1	0.0014	True	Hip (combined)	hip_combined
16	71607358	C	T	rs548397109	TAT	2.6e-07	2.6	0.5	0.00018	4.0	0.0024	True	Sphingomyelins (combined)	SM_combined
18	47108656	T	G	rs41469449	LIPG	2.6e-07	-0.19	0.036	0.037	816.4	0.0024	True	Total phosphoglycerides (combined)	TotPG_combined
8	19816934	T	C	rs301	LPL	2.6e-07	-0.086	0.017	0.22	4793.5	0.0024	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
9	37126334	T	C	rs751424265	ZCCHC7	2.6e-07	0.54	0.1	0.0024	90.2	0.0014	True	Hip (combined)	hip_combined
5	140181423	CA	C		PCDHA1,PCDHA2,PCDHA3	2.7e-07	2.6	0.5	0.0001	4.0	0.0014	True	WHR (combined)	whr_combined
19	50027770	C	A	rs780596384	FCGRT	2.8e-07	-2.0	0.38	0.00032	7.1	0.0024	True	Albumin (combined)	Alb_combined
4	74853287	G	A	rs148885848	PPBP	3.3e-07	0.3	0.058	0.017	305.0	0.003	True	Omega-6 fatty acids (combined)	FAw6_combined
10	54531235	C	T	rs1800450	MBL2	3.3e-07	0.091	0.018	0.15	3712.0	0.0021	True	LDL cholesterol (combined)	S_ldlc_combined
22	44496043	C	T	rs55853196	PARVB	3.4e-07	0.2	0.04	0.038	671.1	0.003	True	Phenylalanine (combined)	Phe_combined
4	145579907	G	A	rs6537301	GYPA,HHIP	3.4e-07	0.053	0.01	0.46	20944.8	0.0014	True	Height (combined)	height_combined
5	75003678	T	C	rs2307111	POC5	3.5e-07	0.068	0.013	0.44	11129.0	0.0021	True	LDL cholesterol (combined)	S_ldlc_combined
1	63001120	A	C	rs1168018	DOCK7	3.8e-07	0.092	0.018	0.24	13268.7	0.0029	True	Saturated fatty acids (combined)	SFA_combined
15	59377940	C	T	rs181181625	RNF111	3.9e-07	0.38	0.075	0.01	183.0	0.0029	True	Docosahexaenoic acid (combined)	DHA_combined
1	55076137	CCACTCCACATTCAGACCGTCATCCCCAGG	C	rs373739034	ACOT11,FAM151A	4e-07	-0.12	0.023	0.1	2193.4	0.0023	True	Remnant cholesterol (combined)	Remnant_C_combined
16	2140803	G	A	rs766551411	PKD1	4e-07	-2.9	0.57	9e-05	3.0	0.0015	True	Glomerular filtration rate (combined)	eGFR_MDRD_combined
10	95139526	A	G	rs10882229	MYOF	4.1e-07	-0.083	0.016	0.38	6698.2	0.0029	True	Omega-3 fatty acids (combined)	FAw3_combined
7	21599233	C	T	rs10950854	DNAH11	4.1e-07	0.057	0.011	0.38	14592.5	0.0013	True	Total cholesterol (combined)	S_totalc_combined
15	59377940	C	T	rs181181625	RNF111	4.3e-07	0.38	0.076	0.01	183.0	0.0029	True	Monounsaturated fatty acids (combined)	MUFA_combined
20	24993220	A	G	rs56222810	ACSS1	4.3e-07	0.16	0.031	0.057	1175.3	0.0025	True	3-hydroxybutyrate (combined)	ln_bOHBut_combined
17	41062979	G	T	rs201961848	G6PC	4.4e-07	0.27	0.054	0.025	429.1	0.0029	True	Monounsaturated fatty acids (combined)	MUFA_combined
18	47108656	T	G	rs41469449	LIPG	4.5e-07	-0.18	0.036	0.037	816.4	0.0023	True	Phosphatidylcholine (combined)	PC_combined
16	57279408	G	GGGGCC	rs536362342	ARL2BP	4.6e-07	-0.19	0.037	0.031	889.4	0.0018	True	ApoA1 (combined)	S_ApoA1_combined
16	57005301	C	T	rs1532625	CETP	4.7e-07	-0.071	0.014	0.41	9112.1	0.0023	True	Concentration of IDL particles (combined)	IDL_P_combined
11	117095283	C	T	rs59781045	PCSK7	4.7e-07	0.11	0.022	0.091	2631.5	0.0018	True	ApoA1 (combined)	S_ApoA1_combined
4	74853287	G	A	rs148885848	PPBP	4.7e-07	0.25	0.05	0.019	412.0	0.0023	True	Total cholesterol in VLDL (combined)	VLDL_C_combined
4	13612630	T	G	rs757565850	BOD1L1	4.7e-07	-2.5	0.5	0.0001	4.0	0.0013	True	WHR (combined)	whr_combined
19	19675696	C	T	rs73004933	PBX4	4.8e-07	-0.17	0.035	0.059	1028.4	0.0029	True	Monounsaturated fatty acids (combined)	MUFA_combined
16	2140803	G	A	rs766551411	PKD1	4.8e-07	2.9	0.57	9e-05	3.0	0.0014	True	Creatinine (combined)	S_krea_combined
6	131942955	A	G		MED23	4.9e-07	-1.5	0.29	0.001	10.0	0.0051	True	WHR (females)	whr_females
4	74853287	G	A	rs148885848	PPBP	5.1e-07	0.29	0.058	0.017	305.0	0.0029	True	Linoleic acid (combined)	LA_combined
1	222922672	G	T	rs954746830	FAM177B	5.1e-07	0.97	0.19	0.0013	29.0	0.0023	True	Sphingomyelins (combined)	SM_combined
9	6533092	C	G	rs138640017	GLDC	5.1e-07	0.27	0.053	0.01	368.0	0.0014	True	Creatinine (combined)	S_krea_combined
11	4107832	C	T	rs192463697	STIM1	5.2e-07	-2.3	0.46	0.0001	4.0	0.0013	True	Height (combined)	height_combined
15	69728081	C	A	rs781486166	KIF23	5.2e-07	-2.0	0.41	0.00027	6.0	0.0023	True	Acetate (combined)	ln_Ace_combined
16	67988588	G	A	rs769184048	SLC12A4	5.2e-07	-2.2	0.45	0.0002	5.0	0.002	True	Alcohol consumption (combined)	ln_totalcw_combined
19	8429323	G	A	rs116843064	ANGPTL4	5.3e-07	-0.23	0.045	0.024	520.1	0.0023	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
19	19675696	C	T	rs73004933	PBX4	5.4e-07	-0.15	0.029	0.059	1474.8	0.002	True	Triglycerides (combined)	ln_S_tottg_combined
4	74853287	G	A	rs148885848	PPBP	5.5e-07	0.25	0.05	0.019	410.0	0.0023	True	Phosphatidylcholine (combined)	PC_combined
19	34943142	A	G		UBA2	5.8e-07	1.6	0.32	0.00027	10.4	0.0013	True	Weight (combined)	weight_combined
5	101816159	G	C	rs142237568	SLCO6A1	6e-07	-0.38	0.076	0.0079	172.8	0.0023	True	Glycoprotein acetyls (combined)	Gp_combined
1	54649648	C	CTAAA	rs369421518,rs781325854	AL357673.1,CYB5RL	6.1e-07	-0.12	0.023	0.12	2691.2	0.0023	True	Concentration of IDL particles (combined)	IDL_P_combined
19	19650614	C	T	rs774984500	CILP2	6.2e-07	-2.8	0.57	0.00014	3.0	0.0023	True	Total cholesterol in HDL2 (combined)	HDL2_C_combined
1	55076137	CCACTCCACATTCAGACCGTCATCCCCAGG	C	rs373739034	ACOT11,FAM151A	6.2e-07	-0.1	0.02	0.1	2894.4	0.0017	True	ApoB (combined)	S_ApoB_combined
1	1424847	C	T	rs916519242	ATAD3B	6.2e-07	0.61	0.12	0.0019	68.8	0.0014	True	C reactive protein (combined)	ln_P_CRP_combined
16	67976823	C	T	rs199717050	LCAT	6.6e-07	-0.49	0.098	0.0037	107.1	0.0017	True	ApoA1 (combined)	S_ApoA1_combined
19	19380513	A	G	rs187429064	TM6SF2	6.7e-07	-0.17	0.034	0.055	971.0	0.0028	True	Omega-6 fatty acids (combined)	FAw6_combined
9	107665739	G	A	rs2575876	ABCA1	6.7e-07	-0.071	0.014	0.18	6757.2	0.0013	True	Total cholesterol (combined)	S_totalc_combined
15	27772977	C	T	rs41276932	GABRG3	6.7e-07	-0.24	0.049	0.023	431.1	0.0026	True	Free fatty acids, 2 hour (combined)	ln_P_ffa120_combined
10	88817434	G	A	rs771182791	GLUD1	6.7e-07	-1.7	0.33	0.00043	9.0	0.0024	True	3-hydroxybutyrate (combined)	ln_bOHBut_combined
5	79336091	C	T	rs200373343	THBS4	6.7e-07	-0.38	0.076	0.0045	172.0	0.0013	True	Weight (combined)	weight_combined
1	109824250	G	A	rs35358959	PSRC1	6.8e-07	-0.11	0.022	0.13	2783.0	0.0022	True	Total cholesterol in IDL (combined)	IDL_C_combined
17	42273328	C	T	rs145523584	ATXN7L3	6.8e-07	0.25	0.051	0.027	474.6	0.0028	True	Monounsaturated fatty acids (combined)	MUFA_combined
11	61564299	G	T	rs4246215	FADS2,FEN1	7.1e-07	-0.071	0.014	0.45	9903.0	0.0022	True	Sphingomyelins (combined)	SM_combined
3	48658844	C	T	rs74783035	TMEM89	7.1e-07	-0.13	0.026	0.081	2347.9	0.0017	True	ApoA1 (combined)	S_ApoA1_combined
7	2802522	T	C	rs798488	AMZ1,GNA12	7.1e-07	-0.055	0.011	0.38	14545.7	0.0013	True	Hip (combined)	hip_combined
11	67021929	G	A	rs3892144	KDM2A	7.3e-07	-0.44	0.089	0.006	132.8	0.0022	True	Citrate (combined)	Cit_combined
15	84473531	G	A	rs7179507	ADAMTSL3	7.3e-07	0.059	0.012	0.32	26088.4	0.0013	True	Hip (combined)	hip_combined
2	84668706	A	C	rs17025048	SUCLG1	7.4e-07	0.52	0.1	0.0045	98.3	0.0022	True	Glycoprotein acetyls (combined)	Gp_combined
22	22051107	C	A	rs45621440	PPIL2	7.5e-07	-0.9	0.18	0.0019	30.3	0.003	True	Glycine (combined)	Gly_combined
13	95860197	C	T	rs11568683	ABCC4	7.5e-07	0.14	0.029	0.033	1267.0	0.0013	True	Diastolic BP (combined)	diastbp_combined
2	28066122	T	C	rs74446114	MRPL33,RBKS	7.6e-07	0.091	0.018	0.19	4172.0	0.0022	True	Concentration of chylomicrons and extremely large VLDL particles (combined)	XXL_VLDL_P_combined
6	43025971	T	C	rs145305278	KLC4,MRPL2	7.8e-07	2.8	0.57	0.00015	3.0	0.0024	True	Glycerol (combined)	Glol_combined
16	71609856	C	T	rs78302875	TAT	7.9e-07	0.16	0.033	0.049	1075.0	0.0022	True	Glycoprotein acetyls (combined)	Gp_combined
11	61564299	G	T	rs4246215	FADS2,FEN1	7.9e-07	-0.059	0.012	0.45	17491.9	0.0013	True	Total cholesterol (combined)	S_totalc_combined
12	53451877	C	T	rs151036307	TNS2	7.9e-07	0.16	0.032	0.03	1168.0	0.0013	True	Systolic BP (combined)	systbp_combined
1	206516327	C	G	rs201481398	SRGAP2	8e-07	-1.7	0.35	0.00036	8.0	0.0022	True	Sphingomyelins (combined)	SM_combined
12	81536987	G	A	rs777947882	ACSS3	8.1e-07	-2.2	0.44	0.00013	5.0	0.0013	True	Waist (combined)	waist_combined
3	126193998	G	A	rs760189912	ZXDC	8.4e-07	-0.79	0.16	0.0024	39.0	0.003	True	Glycine (combined)	Gly_combined
12	20893052	C	A	rs2037154	SLCO1C1	8.4e-07	0.081	0.016	0.39	10593.3	0.0028	True	Tyrosine (combined)	Tyr_combined
15	84568504	A	G	rs6603004	ADAMTSL3	8.4e-07	0.061	0.012	0.49	19653.5	0.0013	True	Height (combined)	height_combined
11	117352857	G	A	rs147554220	DSCAML1	8.4e-07	0.25	0.051	0.016	403.1	0.0019	True	Triglycerides (combined)	ln_S_tottg_combined
8	75937738	A	ATT	rs112989924	CRISPLD1	8.4e-07	-0.074	0.015	0.15	5699.1	0.0013	True	Weight (combined)	weight_combined
17	4692640	G	T	rs79202680	GLTPD2	8.7e-07	-0.2	0.042	0.039	674.6	0.0028	True	Monounsaturated fatty acids (combined)	MUFA_combined
19	18899893	A	G	rs74798576	COMP	8.7e-07	-0.15	0.031	0.047	1192.3	0.0019	True	Triglycerides (combined)	ln_S_tottg_combined
1	111963777	T	G	rs141465498	OVGP1	9e-07	0.83	0.17	0.0017	37.8	0.0022	True	Phosphatidylcholine (combined)	PC_combined
1	62912919	C	T	rs10158897	USP1	9e-07	-0.077	0.016	0.25	6161.0	0.0019	True	LDL cholesterol (combined)	S_ldlc_combined
3	186793372	G	A	rs756391974	ST6GAL1	9e-07	1.8	0.37	0.0004	7.0	0.0028	True	Tyrosine (combined)	Tyr_combined
5	482882	G	A	rs147476976	SLC9A3	9.1e-07	-1.3	0.26	0.00069	15.0	0.0022	True	Albumin (combined)	Alb_combined
6	126072853	C	G	rs2875881	HEY2	9.2e-07	0.052	0.011	0.44	21395.3	0.0013	True	Weight (combined)	weight_combined
14	23872505	T	C	rs182029699	MYH6	9.4e-07	-0.27	0.055	0.0088	336.7	0.0013	True	WHR (combined)	whr_combined
9	6533092	C	G	rs138640017	GLDC	9.5e-07	-0.26	0.053	0.01	368.0	0.0014	True	Glomerular filtration rate (combined)	eGFR_MDRD_combined
11	117097952	C	T	rs2306473	PCSK7	9.5e-07	0.082	0.017	0.21	5337.6	0.0019	True	Triglycerides (combined)	ln_S_tottg_combined
16	74972080	G	A	rs745615725	WDR59	9.5e-07	-2.2	0.45	0.0002	5.0	0.0019	True	Alcohol consumption (combined)	ln_totalcw_combined
5	55809465	A	G	rs173964	C5orf67	9.5e-07	-0.056	0.011	0.33	25907.6	0.0012	True	Waist (combined)	waist_combined
4	57267499	C	T	rs938175552	PPAT	9.7e-07	-2.9	0.59	8e-05	3.0	0.0012	True	Weight (combined)	weight_combined
17	14110236	G	A	rs2230355	COX10	9.8e-07	1.5	0.32	0.00057	10.0	0.0027	True	Tyrosine (combined)	Tyr_combined
7	158436924	T	C	rs35309808	NCAPG2	9.9e-07	-0.21	0.044	0.021	542.9	0.0019	True	Alcohol consumption (combined)	ln_totalcw_combined
7	111400437	GCCAAAAAA	G		DOCK4	9.9e-07	-2.9	0.59	9e-05	3.5	0.0012	True	Weight (combined)	weight_combined